Protokoller

Georfit Bitkiler için DNA Ekstraksiyon Protokülü

Ekstraksiyon Macherey-Nagel şirketinden alınan ‘Genomic DNA from Plant’ kitiyle yapıldı.

REF: 740770.

İŞLEM BASAMAKLARI

1-Kuru yaprak miktarı öğütüldükten sonra 3-8 mg arasında en ideal sonuç elde edildi. Özellikle örneklerin hacimleri birbirinden farklı olduğundan (Farklı cinsler bir arada bulunduğuiçin) öğütülmüş miktarın ependorf tüpünün 0.5 ölçek çizgisinin aşağısında olmasına dikkat edildi. Örnekler sıvı nitrojen kullanılarak iyice öğütüldü.

2-Kitapçıkta CTAB metoduna göre hazırlanan 2a prosedürü takip edildi.

3-400 µl Buffer PL1 tüplere eklendi ve pipet ucuyla iyice karıştırıldı. Vortexde kullanılarak kimyasalın iyice karışması sağlandı. Bu aşama çok önemli. Kimyasal eklendikten sonra örnekler akışkan kıvama gelmediği sürece işlem başarılı olmuyor. Bu nedenle buffer miktarı bazı örneklerde 800  µl’ye kadar çıkartıldı.

4-10 µl RNase A eklendi. RNase kitle beraber kuru halde geliyor. Kullanmadan önce steril su eklenmesi gerekli. Ne kadar su ekleneceği sf 14’de yazıyor. Su eklendikten sonra buzdolabında tutulması lazım. Kuru enzim dışarıda durabilir.

5-Örnekler 65 derecedeki su banyosunda 60-90 dk arasında bekletildi. Uzun bekleme süresinde daha iyi sonuç elde edildi.

6-Kolona violet renkli filtre yerleştiriliyor. Filtrelere örnek numaraları yazıldı. Tüplerde bulunan karışım dikkatli bir şekilde filtrelere aktarıldı. Eğer örnekler en başta iyi karıştırıldıysa kolayca tüm karışım filtrelere geçiyor. Filtreler kapatılıp 4 dk 11000 rpm’de  santrifüj yapıldı. Gerekirse aynı değerlerde tekrar santrifüj yapıldı. Santrifüj bittikten sonra kolona toplanan yeşil sıvı yeni bir ependorf tüpüne alındı, violet filtre atıldı.

7- 450 µl Buffer PC’yi yavaşça ekle ve pipetle. Bazen beyaz bir pelte oluşuyor onu tüpten çıkarmak lazım. Pipetledikten sonra ortalama 5 kez tüpü çevir.

8-Yeşil renkli filtreyi yeni kolona yerleştir ve en fazla 700 µl örnekten alıp filtreye boşalt. Kapatırken dikkat et sıçramasın.

9- 1 dk 11000 rpm’de santrifüj yap ve yıkama aşamasına geç.

10- 400 µl Buffer PW1 ekle 1 dk 11000 rpm’de santrifüj yap. Bu sırada elution Buffer şişesini  su banyosuna koy. Ağzının kapalı olduğunu kontrol et.

11-700 µl Buffer PW2 ekle ve aynı değerlerde tekrar santrüfüj yap.

12-200 µl aynı bufferdan tekrar ekle ve 2 dk santrifüj yap.

13-Şu anda elde ettiğin DNA yeşil filtre üzerindeki beyaz bariyerde. Bu yüzden her basamakta kolondaki sıvı dökülüyor ve yeşil filtre sürekli kullanılıyor. Sakın yanlışlıkla yeşil filtreyi atma.

14-Son santrifüjde bittikten sonra yeşil filtreyi ependorf tüpüne yerleştir ve altındaki kolonu at. Su banyosunda olan elution Buffer’ı al ve 50 µl her filtreye ekle. Örnekleri su banyosunun kapağı açık kalacak şekilde 5 dk su banyosunda beklet.

15-Beş dk sonra örnekleri al ve 11000 rpm-1 dk santrifüj yap. Ependorfun kapağı açık olduğundan kırılmaması için santrifüjün dönme yönünün ters yönünde örnekleri yerleştir.

16-DNA’ yı süzüp tüpün dibinde toplanmasını sağladığımızdan artık yeşil filtreyi atabiliriz. Ependorfu kapat ve DNA miktarını ölç.

 

Geofit Bitkilerin Primerleri ve PCR Protokolü

 

Primer Dizilimi (5′ - 3′)

Kaynak

PCR Koşulları

matK

3F - CGT ACA GTA CTT TTG TGT TTA CGA G

1R - ACC CAG TCC ATC TGG AAA TCT TGG TTC

http://www.kew.org/barcoding/protocols.html

98°C 1 dk; 30 döngüde 95°C 30 s, 52°C 30 s, 72°C 50 s; 72°C 5 dk.

rbcL

F -  ATGTCACCACAAACAGAGACTAAAGC

R -  GTAAAATCAAGTCCACCRCG

Soltis ve diğ (1992)

98°C 30 s; 30 döngüde 98°C 10 s, 53°C 40 s, 72°C 60 s; 72°C 5 dk.

ITS

2F - ATGCGATACTTGGTGTGAAT

4R - TCCTCCGCTTATTGATATGC

 

Chen S, Yao H, Han J ve diğ. (2010) 

98°C 5 dk; 30 döngüde 95°C 10 s, 55°C 60 s, 72°C 1 dk 45 s; 72°C 10 dk.

rpoC1

2F - GGCAAAGAGGGAAGATTTCG

4R -  CCATAAGCATATCTTGAGTTGG

 

http://www.kew.org/barcoding/protocols.html

94°C 1 dk; 30 döngüde 94°C 30 s, 52°C 30 s, 72°C 50 s; 72°C 5 dk.

rpoB

2F  - ATGCAACGTCAAGCAGTTCC

3R  - CCGTATGTGAAAAGAAGTATA

http://www.kew.org/barcoding/protocols.html

98°C 30 s; 30 döngüde 98°C 10 s, 48°C 30 s, 72°C 30 s; 72°C 7 dk.

trnL-F

F  - GGTTCAAGTCCCTCTATCCC

R  - ATTTGAACTGGTGACACGAG

Wongakson ve diğ. (2015)

98°C 30 s; 30 döngüde 98°C 10 s, 54°C 30 s, 72°C 60 s; 72°C 5 dk.

atpB

2F - TATGAGAATCAATCCTACTACTTCT 

611F  - AACGTACTCGTGAAGGAAATGATCT

766R - TAACATCTCGGAAATATTCCGCCAT    

1494R - TCAGTACACAAAGATTTAAGGTCAT

Nguyen ve diğ. (2013)

92°C 3 dk; 30 döngüde 98°C 60 s, 55°C 60 s, 72°C 3 dk; 72°C 7 dk.

rps16

F - GTGGTAGAAAGCAACGTGCGACTT

2R - TCGGGATCGAACATCAATTGCAAC

Yesson ve diğ.(2008)

95°C 5 dk; 30 döngüde 95°C 30 s, 58°C 60 s, 72°C 120 s; 72°C 10 dk.

psbK-I

F - TTAGCCTTTGTTTGGCAAG

R -AGAGTTTGAGAGTAAGCAT  

http://www.kew.org/barcoding/protocols.html

98°C 30 s; 30 döngüde 98°C 10 s, 50°C 40 s, 72°C 40 s; 72°C 5 dk.

atpF-H

F - ACTCGCACACACTCCCTTTCC

R - GCTTTTATGGAAGCTTTAACAAT  

http://www.kew.org/barcoding/protocols.html

98°C 30 s; 30 döngüde 98°C 10 s, 50°C 30 s, 72°C 40 s; 72°C 5 dk.

 

 

 























   EN | TR

PROJE NO: TUBİTAK-KBAG 114Z894